Slektsforum Slektsforum
 HjelpHjelp    SøkSøk     Logg InnLogg Inn  Bli medlemBli DIS medlem  engelsk
Hvordan logge på? Les her om registrering og pålogging.
Start nytt emne    
Vis forrige emne :: Vis neste emne  
Av Innlegg
Skjult navn

Ble registrert: 26 Aug 2006 08:04:57
Innlegg: 226

InnleggSkrevet: 04 Okt 2009 10:06:39    Tittel: Haplogruppe R1b, kan vi stole på resultatet? Svar med Sitat


Først vil jeg takke Vidar for at han har påtatt seg jobben som moderator for et eget DNA-forum.

Overskriften, kan vi stole på resultatet, er delvis provoserende ment.

Helt siden jeg meldte meg på prosjektet til National Geographic har det vært problem med å definere min type.
Mitt resultat var så uklart at jeg ble testet for Y-SNP. Dette var meldingen jeg fikk:

Y-SNP: In the event that the analysis of your STRs was inconclusive, your Y chromosome was also tested for the presence of an
informative Single Nucleotide Polymorphism (SNP). These are mutational changes in a single nucleotide base, and allow researchers
to definitively place you in a genetic haplogroup.

Y-SNP Data Record for M269
NCBI RefSNPID____rs9786153
Location: band____q11.222
Location: gene_____EIF1AY
Ref Sequence base__21077492
Primers: fwd________ctaaagatcagagtatctccctttg
Primers: rev_________aaattgttttcaatttaccag
Equivalent SNPs_____none

Jeg brukte så muligheten, og overførte mine data til Family Tree. Etter en stund får jeg fra FT forslag om å ta en Backbone test.
Dette ble noe uforstålig for meg så jeg sendte denne e-posten:

I have been tested by THE GENOGRAPHIC PROJECT PANEL 1(1-12) and they confirmed I belong to Haplogroup R1b1c (M269).
I then transmitted my data to MyFTDNA in which I asked them to take an expanded test to also include PANEL 2 (13-25) andPANEL 3 (26-37).
Despite this they informed me that my Haplogroup was not determined.
You now suggest that I also take this test; Y-HAP-Backbone -- Backbone SNP... US $65.00
For me it seems rather unnecessary to pay US 65,00 to once again determine my Haplogroup when it has already been established ?
My Kit did not in the first place pass the Quality control at GP, so I understand that I had to take an SNP-test for establishing my Haplogroup.
Copy of the full text from THE GENOGRAPHIC PROJECT is shown below.
I would be grateful if you can give me an explanation to this.

Jeg får så dette svaret:

Dear Family Tree DNA Customer,

During the 3rd Annual Family Tree DNA Conference on Genetic Genealogy, we announced that if we could not predict your haplogroup with
100% confidence, we would run your DNA sample through our Backbone SNP test for free. Please note that the DNA values that you received
are correct, it is the haplogroup that we would like to confirm through this additional test.

Your sample qualifies for this free SNP test and your test will be ordered this afternoon. The test should take approximately three to five weeks and
the results will be posted in both the Haplogroup and Y-DNA DYS Values section of your Family Tree DNA personal page, you will see the results
in the box to the right of the haplogroup assignment. Please note that once you have a confirmed SNP assignment, you will be able to join the
Genographic Project (if you elect to do so and have not already) and you will have a clear and unambiguous SNP position on the “tree” of mankind.

For more about our SNP Assurance Program (the first of its kind in the Genetic Genealogy industry, and as yet unmatched by any other company in the field)
please click the link below:

Best Regards,

Darren Marin
Family Tree DNA

Det som kom ut av dette, det var ingen endring av haplogruppen, som etter hvert har blitt definert som R1b1b2*.

FT foreslår så å ta en test på 67 markøre, dette ser jeg som helt unødvendig da det ikke finnes noen som er i nærheten av min haplotype.
Jeg lar meg ”lokke” til å ta en Backbone test av mine 37 markører, for å fastså hvilken Subclades jeg tilhører.

På nytt kommer det melding som forteller at mitt resultat ikke kan fastslås, og at de må gjøre flere kontroller. Denne gangen gjør de det atomatisk.

Resultatet av alt dette er ja jeg nå tilhører; Haplogruppe: R1b1b2a1b* = L21- M153- M222- M269+ M65- P312+ SRY2627- U106- U152-
Slik jeg forstår dette resultatet, med stjerne, så har det ikke latt seg gjøre å definere eksakt hvor jeg tilhører.

Jeg har funnet fire personer i Norge som er i gruppe R1b1b2a1b, uten stjerne, disse er fra 12 til 20 i Genetic Distance.

Noe som har synspunkter på dette?

Hilsen Knut
Til Toppen
Vis Medlemmets Profil Send Privat Melding
Skjult navn

Ble registrert: 17 Mai 2010 05:14:08
Innlegg: 246
Bosted: Sveits

InnleggSkrevet: 04 Okt 2009 18:05:55    Tittel: Re: Haplogruppe R1b, kan vi stole på resultatet? Svar med Sitat

Hei Knut,
Hvis du ser på ISOGG 2009 siden for Haplogruppen R,, vil du finne at M269+ betyr at du er i subclade R1b1b2 og P312+ i subclade R1b1b2a1a2. Da du er negative for videre subclades, dvs M65-, M153- og M167/SRY2627- blir du R1b1b2a1a2*. Jeg kan ikke finne din R1b1b2a1b* i ISOGG definisjonen så jeg vet ikke hvor du har fått den gruppen ifra.

Hvis du går til DNA Forums for Hg R, ,vil du finne flere tråder der R treet er diskutert, f.eks. , og der vil du finne at R1b1b2a1b er definert med P107+, en mutasjon du ikke har i den listen du gir.

Angående fordelen med å gå til 67 markører hadde jeg akkurat den samme mening som deg, men gjorde det likevel, og jeg ble veldig positivt overrasket. Jeg fikk ett godt treff med mine 67 verdier, som jeg ikke hadde med 37 markører, og dette treffet bragte TMRCA ned flere hundre år, omtrent til "skriftelig historisk" tid, så jeg vil ihvertfall anbefale å gå til 67 markør testen.

Har du lagt resultatene dine inn på ysearch? Hva er din ID?
Til Toppen
Vis Medlemmets Profil Send Privat Melding
Skjult navn

Ble registrert: 26 Aug 2006 08:04:57
Innlegg: 226

InnleggSkrevet: 04 Okt 2009 22:57:45    Tittel: Re: Haplogruppe R1b, kan vi stole på resultatet? Svar med Sitat

Hei Svein!

Ved å gå opp til 67 markører, og på den måten få flere treff, så betyr vel det at treffene som jeg nå ikke har
må bety at treffet ligger på markørene fra 38 til 67.
Jeg får se hva jeg bestemmer meg for. Jeg synes dette blir ganske dyrt etter hvert.

Min ysearch ID er: X5VJU

My Haplotree viser haplogruppen med stjerne, mens skriften under har opplysningen uten stjerne.
Det virker noe forvirrende, og dèt sammen med hele tiden å ha vært nødt til kontrollere ekstra gjør
meg tvilende. Se på bilde.

Her er hva de skriver:
Your Haplogroup test results are now available in the Haplogroup Tree (New) and
Y-DNA DYS Values sections of your personal page. In these sections we list your
haplogroup assignment as determined by the test and a list of all SNP results obtained
in order to complete your test. A "+" indicates your sample contains that particular
SNP mutation, and a "-" indicates that your sample does not possess that particular
SNP mutation.

Please keep in mind that your Haplogroup classification WILL change
as the tree evolves. However your SNP results will NOT change. We will update your
specific Haplogroup definition automatically in the future as the tree evolves and in
agreement with scientific papers.

Det er kanskje her forklaringen ligger, det blir kansje en ny SubClades?
Til Toppen
Vis Medlemmets Profil Send Privat Melding
Skjult navn

Ble registrert: 17 Mai 2010 05:14:08
Innlegg: 246
Bosted: Sveits

InnleggSkrevet: 05 Okt 2009 17:33:09    Tittel: Re: Haplogruppe R1b, kan vi stole på resultatet? Svar med Sitat

Hei Knut,
Ja, det viser seg at FTDNA bruker 2008 versjonen av ISOGG treet for der er P312+ definert som R1b1b2a1b som du sier. Dette med "stjerne" etter Haplogruppen blir ikke observert så mye så når du ser nære treff uten stjerne vet du ikke om de har blitt tested for sub-clades eller ikke. En annen måte å skrive det på som begynner å bli brukt nå er å skrive bare Hg R-P312. Dvs hovedgruppen, R, plus den siste mutasjonen som har testet posetivt.

Du må besøke hvor du finner mange diskusjoner om Hg R.

Hos meg var det treff i 37-til-67 markørene som gjorde forskjellen i hvor nær jeg kom til "søskenbarn" jeg ikke hadde med 37 markører.
Til Toppen
Vis Medlemmets Profil Send Privat Melding
Skjult navn

Ble registrert: 26 Aug 2006 08:04:57
Innlegg: 226

InnleggSkrevet: 05 Okt 2009 18:39:21    Tittel: Re: Haplogruppe R1b, kan vi stole på resultatet? Svar med Sitat

Hei Svein!

Takker for klargjøringen.

Skal ta et besøke til

Kanskje jeg sender en e-post til FTDNA og spør om en forklaring.

Det er jo litt rart, når de går for å være blant de beste på området, at de ikke
er oppdatert/synkronisert på det som gjelder typebetegnelse.

Saken er vel den at det er vi som betaler for å lære dem opp.
Til Toppen
Vis Medlemmets Profil Send Privat Melding
Vis Innlegg fra:   
Start nytt emne Alle klokkeslett er CET (Europa)
Side 1 av 1
Gå til:  
Du kan ikke starte nye emner i dette forumet
Du kan ikke svare på emner i dette forumet
Du kan ikke endre dine egne innlegg i dette forumet
Du kan ikke slette dine egne innlegg i dette forumet
Du kan ikke laste opp filer til dette forumet
Du kan ikke laste ned filer fra dette forumet

Powered by phpBB 2.0.14 © 2001, 2002 phpBB Group